Phee401e vector

Author: bqjt

August undefined, 2024

WebpHEE401E (Plasmid #71287) Print Enlarge View all sequences Purpose Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for … Plasmid pHEE401 from Dr. Qi-Jun Chen's lab contains the inserts sgRNA scaffold … Plasmid pCBC-DT1T2 from Dr. Qi-Jun Chen's lab contains the insert T1, U626t … WebI am trying to synthesize CRISPR constructs, using Golden Gate to put my sgRNAs in the pHEE401E vector. Whenever I do colony PCR with my original primers, it appears that the reaction worked as I...

pHEE401E vector map and sequence - novoprolabs.com

WebThe vector pHEE401E was used as an acceptor vector. The CRISPR-associated endonuclease zCas9 was from the Zea mays, driven by Arabidopsis EC1.1 (AT1G76750) promoter (Xing et al., 2014). Homozygous transgenic plants were identified using PCR-based and sequenced genotyping. All primers used for genotyping are listed in Supplemental … WebJun 22, 2024 · An mCherry gene under the control of a seed-specific At2S3 promoter was cloned into the plasmid pHEE401E to generate pHEE401E-mCherry 14,16. ... we used the … literary magazines that publish book reviews

pHEE401E - Lifeasible

WebpHEE401E (~100 ng/μl) 2 μl 10× T4 DNA Ligase Buffer (NEB) 1.5 μl 10× BSA 1.5 μl BsaI (NE B) 1 μl T4 DNA Ligase (HC, NEB) 1 μl ddH 2 O 6 μl Total volume 15 μl 5. Transform E.coli … WebDownload scientific diagram 4: Egg cell-specific promoter-controlled CRISPR/Cas9 binary vector pHEE401E: Two sgRNA expression cassettes pHEE401E vector was used to create … WebpHEE401E vector Sequence Copy Sequence Download GeneBank File(.gb) LOCUS Exported 17112 bp ds-DNA circular SYN 13-MAY-2024 DEFINITION Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target ACCESSION . VERSION . literary magazines philadelphia

Targeted mutagenesis of the Arabidopsis GROWTH

The Tomato Transcription Factor SlNAC063 Is Required for …

WebNov 22, 2024 · The vectors used were pHEE401E_UBQ_Bar and pBAtC_tRNA, which employ a one-promoter/one-sgRNA and a polycistronic-tRNA-gRNA strategy, respectively. Golden … WebModified from the pHEE401E T-DNA vector described by Wang &al. (2015) Genome Biol 16: 144, doi:10.1186/s13059-015-0715-0: the Hygromycin selection maker of the T-DNA was exchanged with a cassette enabling selection on the basis of CFP-fluorescence in seeds; the egg-cell specific promoter of Cas9 was exchanged with a ubiquitin promoter. importance of the i have a dream speechWebJul 24, 2024 · By Gibson Assembly, this element was ligated into the pHEE401E binary vector (Wang et al., 2015) digested by restriction endonuclease BsaI. We added the BsaI restriction site to the GL2-2Tar-F/R primers, so the final vector still retained the BsaI cutting site, allowing for the insertion of sgRNAs for target loci of interest. literary magazines for kids

"WebJan 7, 2024 · pHEE401E article : bacterial resistance : Kanamycin cloning : growth notes : Please see the cloning protocol attachments for detailed descriptions on how to insert sgRNA sequences into this plasmid. growth strain : Egg cell-specific promoter-controlled expression of 3 FLAG-NLS-zCas9-NLS. " - Phee401e vector

Phee401e vector

WebpHSE401 (Plasmid #62201) Print Enlarge View all sequences Purpose CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA … WebNov 22, 2024 · The pHEE401E vector has a type IIS restriction-enzyme-recognition site for ligation [6]. The other is a pBAtC-tRNA vector that uses a polycistronic tRNA-gRNA expression system and has two AarI type IIS restriction enzyme sites. Originally, these two vectors could carry two sgRNAs.

Did you know?

WebNov 22, 2024 · The pHEE401E_UBQ_Bar vector is a version in which the egg-specific promoter for Cas9 expression in the pHEE401E vector was replaced with the UBQ10 …

Webprimer set and ligation strategy, the pHEE401E vector can carry four sgRNAs, and the pBAtC-tRNA vector can carry four to six sgRNAs. 2. Experimental Design Two main vectors were … WebApr 13, 2024 · To generate mutants of npf8.4-2 and npf8.4-3, two single guide RNAs (AGTTCCGGGTCTTAAGCCAG and GAGATGCAAACACTAACCCG; Genomics Inc.) targeting NPF8.4 were inserted into the binary vector pHEE401E ...

WebGenetic transformation (GT) has emerged as a powerful tool for exploration of plant-RKN interactions and genetic improvement of RKN resistance. However, it is usually difficult to achieve a highly efficient and stable GT protocol for most crops due to the complexity of this process. Results WebJan 17, 2024 · pHEE401E binary vector. pHEE401E is based on pCambia backbone for Agrobacterium-mediated transformation. It contains the complementary parts of the …

WebsgRNA sequence and cloned into pHEE401E binary vector, resulting in the production of pHEE401E-BUPS. With aim at knockouting RALF4 and RALF19 at the same time, we …

WebDec 19, 2024 · To construct pHEE401E ( Wang et al., 2015) vectors targeting four different sites of PAR1 and one site of JAZ1 or GAI, the dsDNA was fused to the Bs a I-digested vector pHEE401E using T4 DNA ligase (EL0011, Thermo Scientific™). importance of the hypostatic unionWebJul 21, 2015 · Arabidopsis mutants produced by constitutive overexpression of the CRISPR/Cas9 genome editing system are usually mosaics in the T1 generation. In this study, we used egg cell-specific promoters to drive the expression of Cas9 and obtained non-mosaic T1 mutants for multiple target genes with high efficiency. Comparisons of 12 … literary magazines that pay ploughsharesWebJan 20, 2024 · Agrobacterium cells harboring the pHEE401E plasmid were grown in Luria–Bertani medium for 2 d and then resuspended with 10 mL liquid MS medium. Disks (1 × 1 cm) were cut from N. benthamiana leaves using a scalpel and soaked in the Agrobacterium solution for 5 min. Leaf disks were then removed and placed onto the MS0 … importance of the homestead actWebAug 16, 2024 · Building on the pHEE401E plasmid, a Cambia T-DNA adapted for 96 genome editing with CRISPR/Cas9 nucleases (Wang & al., 2015), we created a series of 97 vectors enabling selection and counter-selection of transgenics on the basis of seed 98 fluorescence. Toward this end, we replaced the hygromycin resistance marker of pHEE401E importance of the hundred years warWebDec 19, 2024 · To construct pHEE401E (Wang et al., 2015) vectors targeting four different sites of PAR1 and one site of JAZ1 or GAI, the dsDNA was fused to the BsaI-digested … importance of the incarnation for catholicsWebLxiyu 6 Pack Pool Filter for Type I Filters Pump, Compatible with Bestway 58093 Filter,for Spa Filter Pool Pump Flowclear 58381 58511e 300/330 Gal/H (220-240 V) 4.5 (99) $2199. … literary magazines that accept short storiesWebName. pHEE401E. Type. plasmid. Tair Accession. Vector:6531224345. Description. CRISPR/Cas9 vector with maize codon-optimized Cas9 between egg cell-specific enhancer/promoter combination (EC1.2en/EC1.1p) and rbcS-E9 terminator. Host Strain. literary magazines that publish older writers